Help instructions
The base element of phiSITE is defined as a site, representing one
regulatory element present on a phage genome. This can be either
promoter, operator, transcription terminator or attachment site. Site
element can be segmented into several subsites (if known) - particular
cis-regulatory signals (e.g. -35 and -10 for prokaryotic promoter). The
database provides also references to the method of evidence for
experimentally confirmed sites. All sites are linked to the other
phiSITE tables describing the phage and its features. Information about
complete phage genome is also included (if available), together with
names and positions of all known genes. phiSITE keeps also updated
information about phage and phage host taxonomy, together with numerous
links to other database resources described in section "Phage genome
browser" below. There are also several accompanying analyzing tools
under development, accessible in the Tools section.
HOME
This section provides general information about the phiSITE database protal.
SEARCH
Quick and Advanced Search
User can search the content of a database using Quick Search or Advanced Search.
Search terms are looked up either in all text fields (phage name, host
name, site name, site description or site type) or in a single field
selected by a user. In Advance Search, different search fields for each
search term can be specified, with an optional usage of wildcards
(wildcards are always used in Quick Search). Search results are provided
in a form of table with customizable order. Each entry includes site
name, link to the phiGENOME browser 
and Regulation secton 
(if defined), site type (promoter, operator,
terminator or attachment site), method of evidence (
for experimentaly confirmed and 
for predicted sites), source
reference (PubMed article, book or EMBL entry), phage details and
semi-graphical representation of DNA segment containing the site. All
sites are linked to the Sequence Ontology 
thesaurus. Arbitrary number of
entries from search result page can be manually selected and exported
using browse and export module described below.
Select
all |
↓ Name |
Type |
Evidence
Method |
Reference |
Phage |
Sequence |
|---|
|
PR
|
|
| PubMed | |
37978..38033
ACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTACTAAGG |
BROWSE and export
Set of phiSITE entries can be exported using dynamic browse and export module and used in
further analyses in a variety of bioinformatics tools. User can select a
group of sites according to the phage or
phage host taxonomic
hierarchy. Evidence (experimental, predicted or both) and site and
subsite types can be also selected. Each taxonomic selection
step is coupled with background counting of sites currently selected.
After selection, user has an option (i) to build motif representation
for selected sites, (ii) to export sites as FASTA sequences or (iii) to
export selected site in XML format. Selecting Build motif representation
is followed by a sequence alignment assembly process mediated by a
ClustalW2 algorithm and the motif is exported in several output formats:
TRANSFAC database, FASTA, Patser, PromScan, PWM (Postion Weight Matrix)
and Sequence logo. XML format is based on XML version 1.0 specification
and the output file is coupled with XML DOM document.
PHAGES
This section provides detailed information about phage taxonomy,
phage genome and phage gene regualtion as well as numerous links to
other related databases. User can select the pahge of interest from the
pull down menu. If the data are not available for the phage,
its name is in gray an can not be selected.
Features
Basic information about the phage is sumarised in this table. Besides
the phage and phage host taxonomical classification, user is presented
with links to the EMBL, UniProt, Taxonomy, NCBI Genome and ICTVdb
databaes. Dynamicaly generated list of phage related articles in PubMed
Central and two other internal links (BioTapestry Viewer
- see below, and direct
link to the list of all regulatory sites associated with a phage) are
also present.
We have adapted BioTapestry
tool (Longabaugh et al. 2009) for visual representation of phage GRNs (Gene
regulatory networks). Gene regulation
interaction information is extracted from scientific literature and
entered into the model. Source type 'gene' is used for genes and gene
products, and source type 'box for regulatory sites. Several types of
interactions are described in the BioTapestry model: (i) initiation of
transcription of a gene from promoter, (ii) activation of transcription
by a product of phage gene, (iii) repression of transcription by a
product of a gene binding to the operator of target promoter, (iv)
repression of transcription by the operator negatively influencing
promoter, (v) termination of transcription initiated from the promoter
and (vi) antitermination of transcription by a product of antiterminator
gene. Positive regulation is depicted as an arrowed line pointing from
the master to the slave element (i, ii, iii), negative regulations as a
'T' shaped line pointing to the slave element (iv, vi) and neutral
relation as a straight line between master and slave elements (v. Only
interactions among the phage genome elements are defined at the moment,
though future versions may include also phage host regulatory elements.
phiGENOME
The portal possess proprietary graphical genome browser phiGENOME. It provides
a graphical representation of all phage genes and regulatory sites where
all elements are zoomable up to the primary sequence level. User can use
a mouse to zoom in/out and to drag along the genome sequence. All
elements (genes and regulatory sites) are labelled with a name and a
short description. Lower part of the screen shows HTML-based Sequence
Browser, where additional details are showen. Clicking the element (or
its label) selects it and visualise additional information. User can
show and use both part of the screen, or use only the upper graphical
applet (to save CPU and network resources).
Flash applet requires Adobe Flash Player plug-in from version 9.
Regulations
Legend
TOOLS
We provide few simple tools to be used for exploring gene regulatory
elements. Each tool is presented with its own help page accessible by
clicking the question mark.
PSSM-convert
The program for PSSMs creation and for conversion of PSSM formats.
Free Energy
The program for computation of Gibbs free energy distribution in DNA sequence.
Promoter Hunter
Tool for promoter search in prokaryotic genomes.
LINKS
Web links related to gene regulation databases and tools.
DOWNLOAD
Content of the whole database can be downloaded in XML format.
PSSM-convert
tool is also available for download and off-line use.
HELP
This help page.
Any questions?
Please do not hesitate to contact the authors regarding any problems you
can encounter on the phiSITE portal.